Understand Inclusive Learning and Teaching in Lifelong Learning Essay Example for Free

Understand Inclusive Learning and Teaching in Lifelong Learning Essay 1.1 Summarise Learning and teaching strategies used in own specialism Within my own specialty field having a variety of teaching methods and strategies to potentiate learning is an absolute requirement. The field caters to people from all kinds of backgrounds and levels of education so it must be flexible and adaptable enough to appeal to its varied audience. It is usually taught following a mix of teaching methods that focus on different learning strategies, and can be identified as being an â€Å"Interactive Lecture† with some slight variations. It usually starts with a short lecture that lasts for approximately 15 minutes and usually contains a metaphor, as a way of introducing the subject and determining the boundaries by which the session is going to be ruled and also a list of natural examples, that is, situations or contexts where the particular topic being taught could be applied. Demonstrations follow so as to allow the students to familiarize themselves with the concepts to be studied in any given class, and also to give them the opportunity to see first hand what the topic being demonstrated means and gives them a rough idea of what steps are to follow. These demonstrations usually take only form 5 o 10 minutes and can be demonstrated by the teacher on a voluntary student or it can occur in the form of Video, where another teacher or practitioner of the craft demonstrates the topic of the class. Discussion between the students about what they have seen, is a very useful part of assimilating what has been observed in the demonstration and it is also a way to check and evaluate if the students have understood what was going on during the demonstration and check if they have been able to recognize the steps followed during the demonstration to achieve the end result. Getting the students to put into Practice their learning is another way to immediately test their understanding and capability at carrying out what was demonstrated during the demonstration. This can be replaced by a Small Group Task, or a group or individual project where the students can test their skills in carrying out parts of what the demonstration entailed in addition of providing further information and develop their interaction skills within a team. More small group discussions occurs after the students get to practice what they saw in the demonstration, where they get to comment and talk about difficulties, challenges and opinions in regards to how they found putting to practice and finally share their conclusions with the class. The teacher ends the class by a small lecture style talk where s/he summarizes the key points reached during the class, and gives closure to the subjects of the session. 1.2 Explain how approaches to learning and teaching in own specialism that are inclusive and meet the needs of learners A number of students that attend courses within my own field of specialism are blind, colour blind, dyslexic, or present some kind of â€Å"learning disabilities†. Something that is always taken into account, are the learning strategies of the students that participate in any given class, their particular learning needs and other requirements that might be needed to support them in their learning process, this information is discovered through an initial questionnaire at the start of the course. With activities that require interaction with colour or visual elements, the games/activities are adapted or modified in order to compensate for the barrier or disability/ies some particular students might present, by utilizing other senses as a way to replace the visual/colour component. Adapting other materials, activities and games, bringing in flexibility to the exercises is part of the process to teach in my own specialism that are inclusive and meet the needs of the learners. 2.1 Explain how to select resources that meet the need of learners Selecting the resources that meet the needs of the learners is a constant process of consistent evaluation and change. Some of the factors that can influence the teaching methods utilized in any given context are the level of knowledge and the level of commitment of the participants, which links with the level of responsibility they are able to cope with on their own, in addition to their preferred learning system/style, or any other physical, cultural, hearing, language or learning needs. Things such as the class environment and resource/teaching budget are also important; resources can be costly so establishing a sharing scheme or setting up small groups per resource can also be a good idea if it is not possible to find a suitable cheaper alternative. The characteristics of the room Hand-outs are one of the resources that can be provided in the form of notes, extra information, the student ´s can always look back and refer to, when their preferred learning strategies are visual. Worksheets, books, flipcharts, printed quizzes in addition to textbooks and journals are also wonderful ways to potentiate learning through the visual sense, Whiteboards, blackboards, PowerPoint presentations, digital cameras, software, YouTube, other hardware or equipment and Moodle are more interactive ways of learning and their effectiveness depends on the suitability of methods for promoting learning. Knowing enough about the possibilities available and having the skill to confidently utilize it for it to be effective is also important, in addition to the fact that a constant evaluation system should always be in place with the purpose of being able to make rapid changes whenever a teaching method does not have the results expected, and to find out what is effective and useful for any particular set of students. 2.2 Explain how to provide opportunities for learners to practise their literacy, language, numeracy and ICT It is possible in my field, (NLP, Presentation Skills and performance enhancement) to present students with opportunities that require them to practice their literacy, language, numeracy and ICT skills in a variety of ways. Students are usually required to prepare some class with some recommended reading books, journals or articles, (depending on the particular aims of the course), occasions where they are able to practice their literacy and language skills. As communication is a key element in my field, the necessity for them to develop excellent Language skills is key, as it also requires preparation, as elements of clear enunciation, focusing and the design of presentations are usually present in most of the courses within this field. Numeracy skills are in most cases inherent as activities have to be very well timed and managed, and participants usually apply them within their own contexts and backgrounds at the same time they apply the skills learned during my courses, therein, time management, organizational skills and also an adequate level of numeracy are required. Through the skills learned during the course, a higher level of focus can be dedicated to reaching high performance states which in case where a student might have difficulties with numeracy, if s/he so desires, s/he could have the choice to choose it s a context and create a correlation between a particular high performance state (different from their usual nervous/uncertain state) and numeracy. Students can develop or practice their ICT skills through the recommended online research and utilization of many online resources (forums, articles, blogs) that are available online for students, free of charge, in addition to having to prepare (in some courses), rough drafts for presentations to be handed in. 3.1 Explain ways to engage and motivate learners in an inclusive learning environment There are many ways to engage and motivate learners in an inclusive learning environment. First of all, as per the teaching and learning cycle, it is important to identify needs that could be fulfilled or covered in any particular way, for that it would be a requirement to have a target audience so as to be able to study, search and find what the potential target audience could want. Finding out what is of interest to them, so as to be able to develop an appropriate teaching strategy is crucial in order to engage and motivate learners, examples should be relevant to them. Ideally the competencies or skills to be taught could be taught through a utilization of content that is of interests them. We call â€Å"flora† many different types of flowers, they all have the same structure (form), a stem, a pistil, petals, pollen, etc.; but the shapes (content) they take are very different, a Lily looks very different from a Rose and from a Bird of Paradise, a Daffodil or a Cherry Blossom. In the same way, by keeping the intention (purpose/form) of an exercise the same and giving it a shape (content) that is of interest to the students, there is a higher possibility of getting the interest of the students, thus engaging them and motivating them to participate in the activity/ies planned for the session. Realizing, recognizing and acknowledging the differences between students, and respecting those differences, adjusting explanations, language and resources to include all participants is bound to also increase their engagement in the topic being covered. Acknowledging and recognizing the achievements of the students in the process of achieving the â€Å"big goals† and reminding them of the goals that are to be reached at the end of the course while involving them in the process of taking responsibility for their own goals and reasons for being in the course. Providing the students and participants with clear, specific and useful feedback that addresses specific areas or details that are lacking or would need further revision or study, with instructions of how to improve them or overcome them, is another responsibility of the teacher which potentially has great results in involving and engaging the participants of a course. 3.2 Explain ways to establish ground rules with learners to promote respect for others It is important for the facilitators of learning to establish an appropriate micro culture within the members of a class. The way students interact with their environment, with each other (psychological climate) and the interactions between students and teachers sometimes must be defined and agreed to since the start in order to avoid misunderstandings or problems due to â€Å"assuming† that a set of ground rules were â€Å"obvious† and â€Å"logical†. These sets of behavioural rules, determined in consensus by the class during a session dedicated specially to designing these rules could include punctuality, part of this can be represented by arriving to class on time, respecting time allocated for breaks, (coming back on time) and ending class at the finishing time, unless a special project or other activity is taking place which would take a few more minutes. Coming prepared to class is a very important ground rule, that would include bringing to class the materials (books, notes, pens, paper, etc) recommended by the teacher and having brought in homework, having studied or revised the learning materials in order to be a participative element in the class, by talking in turns, providing responses and sharing point of view in class. In the same topic, another ground rule to take into account in the subject of participating in class is to listen and respect the opinions and arguments of other classmates or teachers, even if those opinions differ from ones own, note that respecting does not mean â€Å"having to agree†, it simply means that the topic of disagreement or discordance is open for discussion, sometimes to be expanded on at a later time. Participation in class, or the voicing of opinions, questions or doubts is essential for ensuring the concepts covered in class are well understood, it is capital to note that there must be an element of trust and confidentiality within the group so as to be able to talk freely without fear or recrimination or judgement. If feedback is to be provided in any kind of occasions it must be done in a respectful manner, with appropriate language. Following upon the concept of respect, the respect for the study/learning time is essential and can be demonstrated by switching off (or putting on silent, all electronic equipment that is not needed during the class; that includes telephones, music players, iPads, tablets, computers, and all other electronic devises that could be a disturbance to the progression of the session. These rules are to be followed and reinforced within the group though the discussion and sharing these responsibilities, emphasizing how these ground rules are to help and support not only the teacher, but the students, in the learning process.

Porters 5 Force for Hotel Essay Example for Free

Porters 5 Force for Hotel Essay The combined forces of an economic recession and H1N1 epidemic are causing the hotel industry to suffer in a time of great challenge. Business travel is down because of the recession and the pandemic has significantly reduced tourism. This paper considers three types of hoteliers in current market conditions in light of Porter’s theories. Now, more than ever, Porter’s well regarded thoughts on business strategy and the Internet, first published in 2001, are crucial to consider and they contribute to an analysis and critique of the hotel industry’s internet strategy. In his Harvard Business Review article of 2001 Porter said â€Å"To find the answer we need to look beyond the immediate market signals to the two fundamental factors that determine profitability: Industry structure, which determines the profitability of the average competitor and sustainable competitive advantage which allows a company to outperform the average competitor† (Porter, 2001). This paper examines the five forces which impact competitiveness within and thus the profitability of a competitor in the hotel industry. From the guidance provided in the Five Factor Model recommendations are made to enhance and refine internet strategy for the considered hotel chains. Hotels The hotels chosen for this paper are: Vintage Inns primarily located in Niagara-on-the-Lake, Canada, Sheraton Hotel chain and Best Western Hotel Chain. â€Å"Every business must design a strategy for achieving its goals, consisting of marketing strategy and compatible technological strategy and sourcing strategy†. (Kotler Keller,2006) â€Å"To identify rivals in the international hotel industry, current practice is to use price, segment and proximity† (Matthew, 2000). In previous work, Michael Porter outlined three additional generic strategies that could be used. These are: overall cost leadership, differentiation, and focus. â€Å"The point to be understood here is that any company can have a core competence, but it is competitive competence which gives them a chance to win. For example, Ritz-Carlton, Fairmont, Loews, Four Seasons, Intern-Continental, W Hotel, Hotel Sofitel, Le Meridien are ruling the hospitality industry. This is because of there ability to set up state of the art hotels and their ability to provide exceptional customer service with focus on customer relationship management. The customer relationship is a unique selling point (USP). The â€Å"Service† is both their core competitiveness and also their competitive competence† (Trehan, 2005) Porter’s Five Factor Model According to Porter (2001) the internet is an enabling technology that can be used within the context of a good business strategy in any industry. Although the Internet alters industry structures and levels the competitive ground often dampening profitability in the industry, it can be used to encourage and promote greater profitability if properly implemented. The five forces that impact competitiveness which are outlined in Porter’s 1980 work are: barriers to entry, threat of substitutes, bargaining power of buyers and sellers, and the rivalry among existing competitors. In 2001 Porter considered these factors in light of the internet technologies. The influence of the internet has been profound especially in the hotel industry. According to Porter each factor has a different relevance or impact on different businesses so they are presented below in order of impact for hotels. Porter indicates that the great paradox of the internet is that the benefits it creates such as making information easily available, reducing purchasing hassles, and marketing which allow customers to find what is of interest are the very things that make it more difficult for companies to â€Å"capture those benefits as profits.† (2001). The most important determinant of a marketplace’s profit potential is the intrinsic power of buyers and sellers. Threat of Substitute Goods In the hotel industry there is usually another hotel just around the corner. They appear in all price ranges, with varying levels of service and amenities. The constant challenge will always be to get the guest to choose your hotel over the competitor. The internet makes the overall market more efficient while expanding the size of the potential market and creating new substitution threats. Given the potency of this threat a superb internet presence is vital. Another ongoing threat is that another hotel chain may erode your customer base with a newly formulated internet approach or marketing campaign. This is supported by the following quote from Luck and Lancaster (2003): â€Å"The development of value chain process analysis, supported by collaborative event management over the Internet, the structuring and the sharing of customer focused value chain data, powerfully enhance the performance of value chains and of electronic commerce.† Bargaining Power of Buyers Business persons choosing a hotel for business travel are savvy consumers and they are comfortable with computer technology. It has become very simple for them to go online and book a hotel. They no longer need travel agents, corporate travel consultants or middle men of any kind to determine where they will stay. Porter’s model predicts this elimination of intermediaries. Tourists are more and more capable of using the internet in the same way but in another fulfillment of Porter’s model, they are more often bonding together in a novel way. They are finding internet businesses like cheaphotels.com which will negotiate or discover bargains for them. Both of these processes shift the bargaining power to the end user as the Porter model predicts and these same freedoms reduce the cost of switching so that loyalty is a thing of the past unless a particular hotel uses its one time opportunity when a customer stays at the hotel to deeply impress the customer with a unique and valuable differentiator. Rivalry among existing competitors The rivalry among competitors in the hotel industry is fierce. When potential customers can learn about a hotel on line, the internet reduces the differences among competitors. People tend to seek the best price for the best experience and the tendency is to reduce price to be competitive. The internet covers wide geographical areas so the market is widened increasing the number of competitors. For example, someone who wants to spend the day in the historic town of Niagara-on-the-:Lake can easily choose a hotel in a near by town if the amenities or the price are better. Variable and fixed costs can be different in areas that are more expensive to live and work making it more difficult for a hotel in Niagara on the Lake to reduce their prices to the level of one in nearby St. Catharines. Barriers to Entry The initial investment in the hotel industry creates quite a barrier to entry but certain barriers to entering the hotel market are reduced by the internet. A presence on the internet reduces upstart marketing costs somewhat, and gives the new competitor access to potential suppliers and resources. Even a bed and breakfast can use the websites of large chains to understand the key marketing concepts and the lures for customers. Switching costs are usually nil for a consumer. (McNurlin, 2006) A vital barrier would be differentiation. A hotel that can differential itself by location, by service, amenities or some other quality has the potential to attract and keep its clients. Another barrier to entry would be expertise. Unfortunately, in a mobile society employees frequently leave one hotel chain to work in another and they take that expertise in terms of training or of experience with them. It is in the areas of expertise and of differentiation that a hotel can make the greatest impact on its client and thereby on its bottom line. In fact many established companies have synergies between their established business and online technology. Bargaining power of suppliers While this is not a substantial threat in the hotel industry it can have impact especially in the area of labor. With an aging population, there are fewer people to fill service industry jobs and hotels which can attract excellent staff have a greater chance of providing excellent and exceptional experiences to their clientele. As part of their internet strategy all hotel chains should have a section on recruitment for employment. The other supplies that are needed by hotels are also easier to attain through internet channels whether originated by the supplier or by the hotel chain. With their products in greater demand by greater numbers of hoteliers suppliers gain some measure of power by competition for their offerings. Recommendations All of the hotels listed above can benefit from internet applications that produce greater value in the value chain. The firm’s infastructure can benefit from financial and ERP systems. Communicating with investors can also be done by internet. Human resources can be managed by the internet as part of the overall strategy as well providing internet based self service personnel and benefits, web based training, internet based sharing of information and knowledge and electronic time and expense reporting. Value can be increased by standardizing technology across multiple locations, forming knowledge directories, and allowing real time access to online booking information. Finally, every hotel could benefit by online inventory control and forecasting systems with suppliers. These improvements can all lead to greater profitability (Porter, 2001) Each type of hotel needs to identify its unique strengths and target market and align its internet strategy to support that identity Will the chain choose to be low cost, or to command a premium price? Distinguishing oneself from the competition becomes vital. This can be enhanced by superior technology, through superior inputs, through better training of staff or through better management. Differentiation adds value but the internet makes it hard to maintain those distinctive strategic positions because it eases change to best practices and it improves operational effectiveness. Never the less such distinctions make the business more profitable. By its basic nature the hotel industry is fragmented. The internet makes it easier for travelers from far and wide to learn about the hotel or to order a room but the customer must still come to the hotel for the service. This makes it more likely that the profitability will be there for when sale is easy to transact and complete the profit margin usually decreases. Porter points out similar examples with Real Estate and with furniture sales. Dealing directly is great for hotels. Other than travel agencies who arranged hotel stays the hotel business has always been a face to face business and this normally sustains the economic value of the transaction. For all of these chains the internet complements rather than cannibalizes established ways of doing business. It becomes one more link in the value chain. Every chain listed below should use its website to attract employees and to communicate a philosophy of management. In the employment section the designers must remember that they are communicating not only to potential employees but also communicating the service standards that the guests can expect. Vintage Inns Vintage Inns started in Niagara-on-the-Lake approximately 25 years ago when a recent immigrant bought many of the established old hotels in town. Since that time a focused business strategy has born fruit. It has established itself as a premium priced set of four diamond and five star hotels in an historical town offering a unique and pampered experience to customers who wish to enjoy the old town atmosphere. Its vision is supported by its internet presence. The site is simple but elegant. It is unaffiliated with rewards programs or with alliance programs and it partners with only two other historical inns in Ontario. It caters to those who have the resources and the wish to experience luxurious accommodations, fine dining, spas and the Shaw Festival theatre and the town’s shopping district in the wine country of Niagara. They cater to tourists, business, and weddings. The Vintage Inn website has a high quality video presentation that attempts to give the viewer a sense of the luxury, indulgence and pleasures available while staying at Vintage Inns. It communicates that the experiences of the town and its resources and history are highly integrated with the luxury experience of the hotels. Internet brands are difficult to build because the tangible experience of physical presence and of human contact are missing but the Vintage Inns video on its website goes a long way toward addressing this branding need. From Porter’s research a hotel chain such as this must differentiate itself to compete. It has chosen first class luxury and setting as differentials. The internet strategy must support those strategies emphasizing an all-encompassing luxury in a setting that provides an arts, cultural and historical experience in every aspect. It needs a website to communicate luxury, unique and pampering experience, to take bookings and demonstrate potential products and services. Like many luxury items, marketing by referral and exclusivity has its appeal so it should not ally with other hotels for internet marketing. They must not join any sell-off sites or organizations to offer rooms at discount prices for that would undermine their luxury status. Similarly joining â€Å"reward programs† would reduce their sense of upper class exclusivity. Alliances on the website must be limited to other luxury experiences such as helicopter rides, exclusive golf clubs and Shaw festival theatre packages, horse and buggy rides to historical sites and specialized wine tour experiences. These act as ‘complements’ in Porter’s view and raise profitability by being uniquely paired with the service provided in a manner that is not available anywhere else. The website must also indicate the hotel’s expertise in providing uncomplicated luxury experience. It should also steer away from any vestige of â€Å"sale prices†. It must erect an internet barrier that says that there is no substitute for luxury and no replacement for a true historical experience. Sheraton Hotels Sheraton Hotels Chain is a worldwide concern. They provide luxury and upscale full-service hotels, resorts and residence and is the largest brand serving in the Starwood alliance. The needs of luxury and upscale business and leisure travelers worldwide are their focus. â€Å" From full-service hotels in major cities to luxurious resorts by the water, Sheraton can be found in the most sought-after cities and resort destinations around the world. Every guest at Sheraton hotels and resorts feels a warm and welcoming connection, the feeling you have when you walk into a place and your favorite song is playing a sense of comfort and belonging. Our most recent innovation, the [emailprotected](SM) with Microsoft, encourages hotel guests to come out of their rooms to enjoy the energy and social opportunities of traveling. At Sheraton, we help our guests connect to what matters most to them, the office, home and the best spots in town.† The luxury experience is limited and focused on the bed, bedding, modern room dà ©cor and complementary spa products in the room. It is augmented by staff training and room service. As Porter pointed out in his 2001 article, some things must be excluded to focus on what the company does best. The website must be easy to use, communicate a comfortable level of luxury for primarily modern business travelers to worldwide destinations, and encourage booking. It also must indicate that the welcome feeling is part of what the staff is trained to provide as an expertise. IT also communicates the standardization of expectation worldwide and the meeting of the human need for connection as a differential. Alliances and reward programs make the cost of switching higher. Especially for the business traveler, for whom rewards are personally redeemable, staying with the chain provides rewards that the individual can enjoy only if they return whether on more business that costs him personally noth ing or for a discounted or free personal stay. This is a clever way to increase the cost of switching.

Antimicrobial and Antioxidant Activity: Secondary Metabolite

Antimicrobial and Antioxidant Activity: Secondary Metabolite Natural products remains a consistent source of drug leads with more than 40% of new chemical entities (NCEs). It has become imperative to explore microorganisms for NCEs and lead drug molecules for the drug discovery. Keeping this in view bioprospecting of microorganisms is carried out from every possible source, including extreme environments like ocean beds, geothermal vents, cold desserts etc., in search of novel strains with promising bioactivities. During the past two decades it has been observed that much wealth of microbial biodiversity with novel biochemistry and secondary metabolite production resides in endophytes. So far, numerous bioactive molecules have been isolated from endophytic fungi. An important step towards tapping their potentials for human welfare including drug discovery and sustainable agriculture, it is very essential to isolate endophytes from various ecological niches. Among the endophytes lichen associate fungi are unique organisms that have potential bioactive properties including, antibiotic, antioxidant, antiviral, anti-inflammatory, analgesic antipyretic, anti-proliferating and cytotoxic activities. In this study endolichenic fungi was isolated from crustose lichen Lecanora sp. collected from Horsley Hills, Andhra Pradesh. The isolated endolichenic fungi was identified as Talaromyces tratensis on the basis of ITS4and ITS5 ribosomal gene sequences. The fermented broth is potential source for anti-metabolites. The metabolites crude active against gram positive, gram negative bacteria and fungal pathogens. The most distinguished free radical scavenging activity was observed for Ethyl acetate extract of fungal mycelium. The EC50 values based on the DPPH (1, 1- Diphenyl-2- Picrylhydrazyl), Hydrogen peroxide and Nitric oxide were 45.50 ±0.01, 32.61 ±0.06 and 66.54 ±0.01 respectively. Keywords: Antioxidant activity, Crustose Lichens, Endolichenic fungi and Talaromyces tratensis The Name endolichenic fungi was introduced by Miadlikowsk in 2004 [1]. Endolichenic fungi signifies a vital ecological group of species that form close associations with lichens [2], which lives as endosymbiotic micro fungi in the thallus of lichens and resemble to endophytic fungi live in the intercellular spaces of the plant hosts [3-5]. To date about 100,000 fungal species are identified even if distant more than one million are expected. The diversity of species and the variety of their habitations, some of them unexplored, this lead to be fungi as a rich source of novel metabolites [6]. Besides that Endolichenic fungi are untapped and new treasured source for bioactive metabolite products [5, 7] Only a few investigations have been reported on the bioactive metabolites of endolichenic fungi, but they have shown great potential to be a new source for structurally diverse and biologically active natural products [5, 8-10]. Secondary metabolic products of endolichenic fungi shows di stinct bioactivities like antimicrobial [5, 9, 11], antiviral [12], antioxidant [13-14] anticancer and cytotoxic [7, 9-10, 13-16]. These bioactive compounds have great prominence in development of pharmaceutical drugs, nutraceuticals and agrochemicals. The present study was carried out to investigate antimicrobial and antioxidant activities of endolichenic fungi Talaromyces tratensis inhabiting the lichen Lecanora spp. Collected from Horsley hills, Andhra Pradesh, India. This research was aimed determining the antimicrobial and antioxidant activity of secondary metabolites present in the ethyl acetate (EtOAc) extract of Talaromyces tratensis fermented in potato dextrose Broth (PDB) and their potential for the production of bioactive compounds. MATERIALS AND METHODS Sample Collection The lichens were collected from Horsley hills (13.66 °N 78.40 °E), 147 km of a part of Sheshachalam Hills range, Andhra Pradesh. The lichens were located at an altitude of 1,290m above sea level. The lichen samples were collected from different substrates and transported into the laboratory in sterilized paper bags. Isolation of Endolichenic Fungi The fungi Talaromyces tratensis isolation was carried out by modified method of Guo et al.,2003 and Kannagara et al.,2009 [17-18]. Healthy lichen thalli were cleaned in running tap water to the remove dust particles, litter and then washed with milli-Q watter. The surface sterilized by consecutive immersion for 4min in 2% Sodium Hypochlorite, with Hydrogen peroxide for 2min followed by immersed in 30 s in 75 % ethanol. The thalli surface were dried with sterile filter papers and aseptically cut into small segments (0.5 ÃÆ'- 1 cm) and were evenly placed in each 90mm Petri dishes containing Potato Dextrose agar (PDA) with Streptomycin Sulphate (50ÃŽÂ ¼g/ 100ml). The PDA plates were sealed with Paraffin film and incubated at 28 °C for 7days. Fungi grown from each lichen segment and make into pure cultures. Slides containing pure cultures were prepared using the slide culture method [19] and identified using identification keys [20]. The growing fungi Talaromyces tratensis were sub -cultured on PDA. Molecular identification of the isolated endolichenic fungus Genomic DNA isolated in the pure form from the fresh biomass of Endolichen fungus by CTAB (N-cetyl N,N, Ntrimethyl -ammonium bromide) method [21], the Identification of isolated pure strain of the endolichenic fungus was carried out using a molecular biological protocol by genomic DNA extraction, internal spacer transcribed (ITS) region amplification and sequencing. The ITS region of rDNA was successfully amplified by PCR was set up with ABI BigDye ® Terminatorv3.1 cycle sequencing kit and using fungal universal primers ITS4 (5à ¢Ã¢â€š ¬Ã‚ ² TCCTCCGCTTATTGATATGC 3à ¢Ã¢â€š ¬Ã‚ ²) ITS5 (5à ¢Ã¢â€š ¬Ã‚ ² GGAAGTAAAAGTCGTAACAAGG 3à ¢Ã¢â€š ¬Ã‚ ²) [22]. It was sequenced in both directions using the respective PCR primers. For this purpose, the Big Dye terminator sequencing kit (Version 3.1, Applied Biosystems) and an ABI 3100 automated DNA sequencer (Applied Biosystems) were used. Raw Gene sequence was manually edited for inconsistency and the predicted sequence data were aligned with public available sequences and analyzed to reach identity by using NCBI BLAST ® (http://www.ncbi.nlm.nih.gov/blast/). Fermentation and extraction: The fermentation was carried out in Erlenmeyer flasks using a complex medium consisting of Potato Dextrose Broth (HIMEDIA Laboratories). The flasks containing 200 mL fermentation medium were inoculated with 5 days old actively growing T. tratensis mycelial agar discs (6mm), the Flask cultures allowed for inoculum development and fermentation at 28 ±2 °C, pH 7.0 with orbital shaking at 120 rpm [23]. After 14days of Fermentation the fungal biomass was separated with Whatman No.1 filter paper from fermented broth and filtered broth was allowed to liquid-liquid separation with EtOAc (1:1 ratio) in a separatory funnel. After this procedure, the organic solvent was evaporated under reduced pressure to dryness to yield an EtOAc extract [24]. Antibacterial Activity: To evaluate Antibacterial activity of T. tratensis EtOAc crude extract tested against gram positive (Bacillus cereus and Staphylococcus aureus) and gram negative bacterial pathogenic strains (Escherecia coli, Pseudomonas fluorescence, Klebsiella pneumonia and Salmonella typhi) by agar well diffusion method [25-26]. Antibacterial activity was expressed as the percent inhibition (%) of bacterial growth using the following formula C-T/C X 100. Antifungal activity The antibacterial activity in in vitro was dilution determined against the pathogenic fungi Fusarium oxysporium, Colletotrichum capsisi and Aspergillus niger by poison food technique [27]. 1 ml of tenfold of the EtOAc extracts were mixed with molten PDA separately and then poured into Petri dishes and control PDA plates supplemented with sterile distilled water. A mycelia disc of tested pathogens was transferred on the center of both test and control plates and incubated for 5days at 28 °C. The mycelial radial was measured and the percentage of inhibition was expressed by using following formula T1 T2/ T1 X 100. Screening for Antioxidant activity DPPH Assay: Free Radical-scavenging activity of T. tratensis extract against stable 2, 2 diphenyl 2 picrylhydrazyl hydrate (DPPH) was determined by the slightly modified method of Prior R.L. et al., 2005 [28]. DPPH reacts with an antioxidant compound which can donate hydrogen and reduce DPPH. The change in colour (from deep violet to light yellow) was measured at 517 nm on a UV visible light spectrophotometer. The solution of DPPH in methanol 0.2mM was prepared fresh daily before UV measurements. One milliliter of this solution was individually mixed with ethyl acetate extracted crude sample of T. tratensis (25mg, 50mg, 100mg and 200mg). The samples were kept in the dark for 15 minutes at room temperature and the decrease in absorbance was measured. The experiment was carried out in triplicate. Radical-scavenging activity was calculated by the following formula Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Whereà °Ã‚ Ã‚ Ã‚ ´blank is the absorbance of the control reaction and à °Ã‚ Ã‚ Ã‚ ´sample is the absorbance in the presence of purified molecules Determination of Antioxidant Activity by Reducing Power Measurement The reducing power of the extract was determined according to Oyaizu 1986 [29] with slight modifications. An amount of 25mg, 50mg, 100mg and 200mg of extracted sample was added to 2mL of 1% potassium ferricyanide. After incubating the mixture at 50 °C for 30 min, during which ferricyanide was reduced to ferrocyanide, it was supplemented with 2mL of 1% trichloroacetic acid and 2% FeCl3 and left for 20 min. Absorbance was read at 700 nm to determine the amount of ferric ferrocyanide (Prussian blue) formed. Higher absorbance of the reaction mixture indicates higher reducing power of the sample. ISSN: 0975-8585 September October 2016 RJPBCS 7(5) Page No. 1415 Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Determination of Nitric Oxide (NO) Scavenging Activity Nitric oxide production from sodium nitroprusside was measured according to Jagetia 2004 [30]. An equal amount (6 mL) of sodium nitroprusside (5mM) solution was mixed with extracted sample (25mg, 50mg, 100mg and 200mg) and incubated at 25 °C for 180 min. After every 30 min, 0.5 mL of the reaction mixture was mixed with an equal amount of Griess reagent (1% sulphanilamide, 2% phosphoric acid, and 0.1% napthylethylene diamine dihydrochloride), and absorbance was taken at 546 nm and compared with absorbance of 1 mg/mL of standard solution (sodium nitrite) treated in the same way with Griess reagent. Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100. RESULTS AND DISCUSSION Endolichenic fungi are residing in living thalli of lichens and that similar to endophytic fungi asymptomatically in internal tissues of all higher plants [3-5]. In Recently the biology of Endolichenic fungi are renowned to interesting novel sources of biologically active compounds. This study focuses on the biology of endolichenic fungi, their discovery, isolation, identification, and their biological activities in invitro. In our present research, we isolated rare and interesting Endolichenic fungus from crustose type lichen Lecanora spp. (Fig.1) collected from Horsley Hills, Andhra Pradesh. The morphological characters of the isolate were slow-growing, yellow in colour, conidiophores having smooth, lateral branching, conidia aseptate, phialides and ascospores (Fig.3). The ITS sequence of endolichenic fungus 100% similarity with Talaromyces tratensis sequences from Gene-Bank and this endolichenic fungus was identified as Talaromyces tratensis (Fig.3). Previously several endolichenic fungi and their bioactive metabolites [7, 11-13] reported nevertheless Talaromyces tratensis newly reporting to produce and interesting bioactive metabolites with antimicrobial, and antioxidant properties. To our knowledge, this is the first report of this organism as an endolichenic fungi from Lichens. Crude metabolites of the T. tratensis were extracted with ethyl acetate as organic solvent by using solvent extraction procedure. The crude extract was evaluated for antibacterial and antifungal activity against some clinically significant microorganisms following agar well diffusion assay and poison food technique respectively. The metabolites displayed moderate to strong antibacterial activity (Fig. 4) against all the test pathogens. The metabolites showed highest in vitro activity against Klebsiella pneumoniae followed by Escherichiacoli, Salmonella typhi, Proteus vulgaris, Bacillus substiles, Pseudomonas fluorescence and Staphylococcus aureus (Table. 1). In food poison technique for antifungal activity (Fig. 5), it shows 82.59% I highest growth inhibition on Colletotrichum capsisi, followed by Aspergillus niger and Fusarium oxysporium (Table. 2). Table. 1: Antibacterial activity of T. tratensis Name of Bacteria % of growth inhibition at different concentration 25ÃŽÂ ¼l 50ÃŽÂ ¼l 75ÃŽÂ ¼l 100ÃŽÂ ¼l Klebsiella pneumoniae 33.56 57.75 66.63 75.94 Escherichia coli 30.93 56.79 66.75 75.66 Salmonella typhi 30.98 56.32 66.52 74.39 Proteus vulgaris 31.70 55.28 66.00 69.83 Bacillus substiles 31.67 48.06 64.86 72.61 Pseudomonas fluorescence 29.38 49.47 64.95 72.61 Staphylococcus aureus 31.67 48.06 64.86 70.94

Miscellaneous Critics on Waiting for Godot :: Waiting Godot Essays

Nothingness â€Å"Accordingly, any interpretation that purports to know who Godot is (or is not), whether he exists whether he will ever come, whether he has ever come, or even whether he may have come without being recognized (or possibly in disguise) is, if not demonstrably wrong, at least not demonstrably right† (Hutchings 27). â€Å"Although works of the theater of the absurd, particularly Beckett’s, are often comical, their underlying premises are wholly serious: the epistemological principle of uncertainty and the inability in the modern age to find a coherent system of meaning, order, or purpose by which to understand our existence and by which to live† (Hutchings 28). Godot’s characters do not despair in the face of their situation, and this â€Å"perseverance remains constant throughout a body of work that, in the words of the citation awarding Beckett the Nobel Prize for Literature in 1969 had ‘transmuted the destitution of modern man into his exaltation’ (qtd. in Bair 606)† (Hutchings 30). â€Å"Many relate the play to existentialism†¦:God is dead, life is absurd, existence precedes essence, ennui is endemic to the human condition†¦In many ways, such a reading is an evasion of the play’s complexity, a way of putting to rest the uncertainty of one’s response to it† (Collins 33). The reader, like modern man, must not give into â€Å"the arrogant presumption of certitude or the debilitating despair of skepticism,† but instead must â€Å"live in uncertainty, poised, by the conditions of our humanity and of the world in which we live, between certitude and skepticism, between presumption and despair â€Å"(Collins 36). Tragicomedy is life enhancing because it tries to â€Å"remind the audience of the real need to face existence ‘knowing the worst,’ which ultimately is liberation, with courage and humility of not taking oneself or one’s own pain too seriously, and to bear all life’s mysteries and uncertainties; and thus to make the most of what we have rather than to hanker after illusory certainties and rewards† (Esslin, Theater 47). â€Å"Act II. The next day. But is it really the next day? Or after? Or before?† (Esslin, Presence 109). Many details point out the absence of (meaninglessness of) traditional time, which is just one of many ways that the play resists interpretation and meaning: â€Å"People misunderstand it on all sides, just as everyone does his own sorrow. Explanations flow in from all quarters, each more pointless than the last† (Esslin, Presence 110). Some of the many attempts to impose meaning on the play include

Essay --

Philip Covarrubias Covarrubias 1 Fire 101-10 Friday 0900-1150 12-06-2013 Iroquois Theater Fire The Iroquois Theatre (Theater) Fire occurred on December 30, 1903, in Chicago, Illinois. It is the deadliest theater fire and the deadliest single-building fire in United States history. A total of 602 people died as a result of the fire. The theatre had three audience levels. The main floor (known as the "orchestra" or "parquet") was on the same level as the Foyer or Grand Stair Hall. The second level (the "dress circle") and the third level (the "gallery") were accessed through broad stairways that led off the foyer. The backstage areas were unusually large, with dressing rooms on five levels, an uncommonly large fly gallery (where scenery was hung), and even an elevator available to transport actors down to the stage level. The Iroquois was Chicago's newest and most polished theater, built by architect Benjamin Marshall, who had studied many fires over the years and had tried to make this particular building as safe as possible. The Iroquois was designed in the image of a famous Paris opera house, and the four-story structure contained elaborates stained glass windows and polished wood. The lobby of the Iroquois had a sixty-foot high ceiling and marble walls, and Marshall had put in as many as twenty-five exits tha t supposedly would allow a capacity crowd to escape any problems in less than five minutes. A curtain made of asbestos was supposed to be present, one that could be lowered from above the stage to protect the audience in case of a fire that started there. But common sense did not prevail when it came to the seats in the Iroqu... ...ned hysteria. But the exit doors opened inward, and the crush of bodies against the people trying to open them did not allow them to do so. Also, many of the side doors were locked. The Iroquois was plunged into darkness as the lights went out, and the fire, fueled by the air coming in from the rear doors, exploded throughout the main auditorium. When the fire company arrived, everything appeared normal, as there was no smoke coming out of the Iroquois Theater at first. But when they went into the building, they could not open the doors because of the bodies that were stacked against them. The death toll in the upper balconies was tremendous, as the fire escape supposedly leading down to the street a hundred feet below was found to be non-existent, leaving some to jump or fall to their death from the great height. As many as 150 people met their fate in this manner.

Auditor Independence – 2

Introduction Independence is a fundamental to the reliability of auditors’ reports. It is an attitude of mind characterized by integrity and an objective approach to professional works. A professional auditor should work both independent and seen to be so. Nowadays, but, the trend of providing non-audit services to audit clients seem to be sweeping accounting firms all over the world; impacts of independence impairment caused by this trend should not be ignored. The Meaning of Independence The essential feature of an audit is its independence and, if an accountant performs the accountancy work and then checks it himself, this checking cannot be viewed to be an audit because it lacks independence. From ACCA’s Code of Ethics, the definition of Independence is composed of independence of mind and independence in appearance. In general, independence means an auditor’s opinion must be based on an objective without bias and disinterested assessment of whether the financial statements are presented fairly in conformity with generally accepted accounting principles. The Importance of Independence in relation to the provision of assurance The value of audit derives entirely from its independence. Without independence, auditors’ opinions lack impacts and credibility. The relationship between the auditors and audit clients, however, gives a potential threat to the independence. Influencing Auditors’ Reports on Clients’ Financial Position due to Conflicts of Interests: Possibilities of conflicts of interest between firms and clients, where situations such as, connections of an audit firm with associated firms, family and other personal relationships, financial interests in audit client, employment with audit clients, provision of non-audit service to audit clients, may consequently affect auditors. Without the strength of character to withstand such pressure, auditors may be unable to express independent opinions. Preserving Investors Confidence in the Financial Market Public confidence in the capital market relies heavily on the appearance of auditor independence. Auditor independence helps to ensure quality audits and sustain the circulations of investment with the capital market. Investor confidence is eroded if investors and other users of the financial statement information do not perceive that the auditor was independent in both fact and appearance. Giving Constructive Advice Although there is no formal obligation, a good auditor will be anxious to offer his client assistance on improvements in the financial aspects of the business if he can give an unbiased independent opinion, where added value is brought to clients and to the wider business community. Lowering Litigations Sustaining independence enables the auditors to objectively report on True and Fair Value of any information required to be disclosed in financial accounts, of which the chances of successful negligence lawsuit to a level acceptable will be reduced. The Nature of other services provided by the auditors In the classification from APB, non-audit services is composed of any engagement where an audit firm provides professional services to an audited client other than the audit of financial statements, and pursuant to those other roles which legislation or regulation specify can be performed by the auditor of the entity. There are five different natures of non-audit services categorized by activities arising directly from an audit of a company’s financial statements, services required to be provided by the auditor by laws, services provided by auditors because of their familiarity with the client and, as a consequence, their ability to perform them in a timely and cost effective manner, services provided because of the pool of accounting and related financial skills available to accountancy firms, services provided because of the pool of consulting and general business skills available to accountancy firms Critical Discussion of Ethical Code Requirements Independence is part of the accountant’s code of professional conduct. Under APB Ethical Standards the concept of auditor independence shifted in favor of objectivity and neutrality in the reporting of the financial position and the results of operations, rather than loyalty to a particular party. The Ethical Standards allow audit firms to offer consulting services such as internal auditing and information technology but are subject to certain restrictions, and audit firms are required to disclose fees received from auditing and all non-audit services. However, without providing clear distinctions which makes grey area exists, the rules should err on the side of caution. Auditors and their clients are likely to continually test the limits of what is permissible, including by litigating restrictions they oppose. UK’s Combined Code on Corporate Governance only recommends that audit committees develop policies to govern the future provision of non-audit services, but does not require a pre-approval of non-audit services by audit committees. No specific enforcement mechanism ensures that management does not become involved, directly or indirectly, in selecting auditors or determining audit fees and the scope of audit. Ethical code requirements should focus to a greater extent on the issue of to what extent client management may still be able to influence the audit fee and the scope of audit engagement. Explanation of the Current and Emerging Developments In order to increase revenue, recently, accounting firms not only provides auditing services, other services including bookkeeping, financial information systems design, human resources and management functions, valuation, internal audit, tax, legal, investment banking services and expert services unrelated to audit, also provides. There are several reasons leading to the increasing popularity of providing non-audit service, Price Competition Auditing becomes a low-profit activity that clients increasingly search for the lowest prices and the loosest standards. Competitive bidding in auditing created pressure to reduce audit engagement hours. To maintain overall revenues, high profitability of the numerous new consulting and other non-audit services is being offered. Horizontal Integration The rapid growth of business enterprises on a worldwide basis provided large accounting firms with an opportunity to become the preferred providers of a wide range of business services, the revenues from non-audit services for audit clients quickly outpaced the fees from auditing-only services. Audit Effectiveness Providing non-audit services allows accounting firms to perform better audits because they can obtain a better understanding of the client’s systems, which can achieve the cost-effective goal. Criticism and Analysis of Independence Impaired by Provision of Non-audit Services The relative increase in reliance on revenues from non-audit services may have placed increased pressure on auditor independence. The major accounting firms, seems vigorously opposed reforms to eliminate the growing conflicts of interest arising from auditing and consulting for the same client, because of economic bond which the auditor does not want to lose developed between the client and the accounting firm. In order to be more competitive, accounting firms try to reduce audit fees to attractive customers by reducing engagement hours. But this risk-based auditing approach may not detect fraudulent activities. Some auditors shifted their concept of independence to becoming trusted advisors to the client’s management. Although acting independence in certain situations is acceptable, too often an auditor’s efforts to help management resulted in concealing true economic performance. It appeared that some auditors ignored their most immediate responsibility to act on behalf of third-party investors or, at a minimum, to be an objective and neutral interpreter of accounting standards. Many non-audit services evolved from requests by audit clients for additional services that their auditors seemed best suited, as well as from the special skills needed to audit new and complex business transactions. Expanding the scope of the specialists’ activities helped firms attract and retain people with skills that were increasing important to effective auditing. Audit firms’ management consulting practices have expended far beyond the skills required for audit support and the traditional areas related to financial planning and controls. Independence questions can arise when these services are marketed to audit clients. However, it is obvious that major accounting firms keep bearing legal risks by providing non-audit services to audit clients. Even ethical standard regarding to provision of non-audit services has been revised; firms could argue that advanced technology and improved education enabled accounting firms to provide many non-audit services to their current client. Conclusion and Recommendations Independence, both historically and philosophically, is the foundation of accounting profession and upon its maintenance depending on the profession’s strength and its stature. From my viewpoint, it is undeniable that Ethical standards put efforts on monitoring auditor independence; but standing at the point of running the business, accounting firms have woven an increasingly complex web of business and financial relationships with their audit clients. The most common case of independence impairment occurs because an auditor becomes so close to the client as to be unable to function objectively. The actual cause of the independence problems, however, generally was not wanton disregard rules. Instead, internal control problems may have caused many of the breach where the weak internal control system is unable to trace employees’ investments. Despite of regulations, area needs to be addressed to improve the auditor independence is the audit firms’ internal control systems, of which all relationships between each auditor and audit clients should be reviewed from time to time. The nature of the non-audit services providing to audit clients maybe different in different era. It appears that there is more mobility of employees and an increase in dual-career families. In the foreseeable future, keeping prohibition on non-audit services would help medium-sized accounting firms secure additional non-audit work with major clients. On the other hand, the increasingly competitive auditing market and the complexity of international business practices may cause some auditors to reduce their focus on objective and neutral interpretation of accounting standards in favor of becoming a trusted advisor for clients. MMUBS Reference Book Graham W. Cosserat and Neil Rodda (2009) Modern Auditing, 3rd ed. , John Wiley & Sons, Ltd Diane Walters and John Dunn (2001) Student‘s Manual of Auditing: The Guide to UK Auditing Practice, 6th ed. , Thomson Learning M. Shere and S. Turley (1991) Current Issues in Auditing, 2nd ed. , Paul Chapman Publishing Ltd Newspaper Article – Internet Copy Editor (2009) ‘Auditor independence important – CMDA’ The Miadhu News. [Online] 4th November. [Accessed on 4th November 2009] http://www. miadhu. com/2009/11/local-news/auditor-independence-important-cmda/ Journal Article – Internet Copy Franklin Strier (2006) ‘Proposals to Improve the Image of the Public Accounting Profession’ CPA Journal, March 2006 Issue http://www. ysscpa. org/cpajournal/2006/306/essentials/p67. htm C. Richard Baker (2005) ‘The Varying Concept of Auditor Independence: Shifting with the Prevailing Environment’ CPA Journal, August 2005 Issue http://www. nysscpa. org/cpajournal/2005/805/infocus/p22. htm Robert H. Colson (2004) ‘CPA Independenc e, Present and Future’ CPA Journal, April 2004 Issue http://www. nysscpa. org/cpajournal/2004/404/essentials/p80. htm Carolyn L. Lousteau and Mark E. Reid (2003) ‘Internal Control Systems for Auditor Independence’ CPA Journal, January 2003 Issue http://www. nysscpa. rg/cpajournal/2003/0103/features/f013603. htm Deborah L. Lindberg and Frank D. Beck (2004) ‘Before and After Enron: CPA’s Views on Auditor Independence’ CPA Journal, November 2004 Issue http://www. nysscpa. org/cpajournal/2004/1104/essentials/p36. htm Mario Christodoulou (2009) ‘Debate rages on over KPMG’s cut-price Rentokil audit deal’ Accountancy Age, 20 August 2009 http://www. accountacyage. com/accountancyage/news/2248103/debate-rages-kpmg-cut-price Internet Source – Organization NASD Notice to Members 02-19. (2002) Auditor Independence: SEC Review of Auditor Independence Rule. Online] [Accessed on March 2002] http://www. finra. org/web/groups/industr y/@ip/@reg/@notice/documents/notices/p003715. pdf Investor Protection (2003) Strengthening the Commission’s Requirements Regarding Auditor Independence. [Online] [Accessed on 20th January 2003] http://www. consumerfed. org/pdfs/011303auditor. pdf Public Oversight Board (2002) Report and Recommendations: Chapter 5: Auditor Independence [Online] [Accessed on March 2002] http://www. pobauditpanel. org/downloads/chapter5. pdf APB (2009) Consultation Paper on audit firms providing non-audit services to

Art Interpretation

An artist’s personal history can be a visual roadmap into their past, subconscious, and their personal reality. The purpose of this paper is to explore these idioms in the work of Gerard Ter Borch and its historical relevance to art. Gerard Ter Borch had an established rapport with his uncle Robert van Voerst, a relationship that enabled the artist to claim his niche as one of Europe’s leading court portraitists. Robert van Voerst’s ties with Charles I began Borch’s career and launched him into his fame and status.With royal backing it is no wonder that Borch kept much of his subject matter dealing with the rich and wealthy instead of the typical Dutch preclusion to the drab or mundane of human life. It is this significant turn of events that lead this discussion to Borch’s sophisticated representation of contemporary life (62). Such representations into modernity of Dutch life can be witnessed in Borch’s painting Curiosity (c. 1660). Since B orch’s family was so closely tied to an aristocratic lifestyle, it is no wonder that the artist’s work would reflect what he so intimately knew.Although the composition of the work is best seen through the use of rich fabrics (as is most of Borch’s work) what should be taken note of is his use of diagonals to illustrate the inner psychology of the characters in his work. The moment of a letter arriving has each woman in the painting ‘curious’ as to its contents, but this curiosity is best exemplified by the woman on the left leaning over the other young woman’s shoulder in order to gain a better view of the letter’s contents. This leaning of the young woman gives the painting an enigmatic feel that is not present in other of Borch’s work.A high profile woman that is a woman of so obvious a rich birth (as can be seen by her clothing) indulges in a dalliance of childish movement making the moment both entertaining and whimsical. T his whimsical nature is given further emphasis by the vast background surrounding the young ladies. That this one woman would allow herself the indulgence of something so trivial as a childish leaning forward among all that tradition and overbearing space (notice the columns in the background as well as the ornate fixture of the diagonally placed mirror) is what is so appealing about this piece of work.The reason for the letter writing with this trio of women is that Borch had a very close relationship with his half sisters, â€Å"[which] surely contributed to his affectionate sensitivity to how young women might behave on such an occasion† (76). With Borch’s obvious eye for the smallest detail a closer examination of the painting must be given, including symbolism for such objects. Of note in such objects is the watch key which precariously dangles over the edge of the table.The symbolism of such a state for a watch winding key could mean for the viewer to take specia l note of temperance which would make sense with Borch having been raised in the Eastern Netherlands and privy to that regions Protestant upbringing. Since the objects on the table are of such small stature, from the candlestick to the watch winding key to even the letter itself, the viewer may imagine that the symbolism of such objects do not have equal weight as the characters themselves; therefore, motive for the letter takes precedence over any idea of temperance.However, with Borch’s style leaning toward developing and understanding human behavior it may be worthwhile to ask Why did the artist choose to include a moral lesson in such small objects if not to make a point? Indeed, this curiosity of The Curiosity is the reason why the painting is known as a conversatiestuk or conversation piece. With such small detail making an impact on critiques and viewers alike what becomes predominately clear in studying Borch is that he continually uses small objects to emphasize his study of human behavior.Upon first looking at The Curiosity a viewer is not completely aware of all of the objects in the composition. The element of light is what makes these objects more noticeable; such as the winding key on the table’s ledge that gives off a golden hue and is further emphasized by the spaniel’s body language pointing to the key. If the element of light is to be discussed in The Curiosity then most notably the woman on the right shimmers with luminescence – her costume as well as her countenance.With such brilliance transposing the portrait it is a wonder that the woman stands at such a distance from the main action of the painting. This distance is only emphasized by Borch’s use of light on her. This leads the viewer to wonder the cause of the distance and to become enraptured by the back story of the moment of the painting and the relationship among these three women. Thus, by the use of light, Borch has made the viewer not only appr eciate a fine painting but to become engrossed in the psychology of the characters and their reasons for standing the way he has painted them.In this psychological history of the women, the viewer becomes aware of something else; a voyeuristic tone to the painting. The intimate moment of a woman opening a letter that may (by the stance of the women surrounding her) be from a lover or gentleman caller makes the viewer realize that the painter is a man, and that the interest of all of the women is of a man. Thus, the painter through these psychological stances becomes the object of the viewer’s scrutiny (76).Upon revisiting the painter as the background object of the painting, the viewer must once again re-examine the objects on the table and their significance to the painter’s life. The time piece once again must be examined not as an abstract composition of temperance but as a revelation to the viewer of the artist’s own timeframe. Time is often associated with death, thereby; the death of the painter’s uncle during this time is significant. It is the uncle who allowed him his introduction to Charles I and which thereby gained him his entrance into the art world.It seems that Borch is writing his own life history in the small objects on the table. The death of Borch’s mother Anna Bufkens would perhaps be also realistically attached to the significance to the time piece. The complex nature of the painting is revealed; the women gathering around the letter are anxious to find out the lover’s intentions but the objects on the table tell of lives and lovers past. Love quickly follows death for the viewers in Borch’s painting.With so much psychology behind the small objects involved in Borch’s painting The Curiosity it cannot be said that the painting is for mere visual enjoyment that is most definitely not a conversatiestuk –it is far more than just a simple conversation piece. Without the use of light , of lines, and of composition such nuisances of Borch’s style would be lost on the viewer. Thus, the importance of these artistic styles is what ultimately makes the painter so interesting to the art world. If Borch desired to make a moralizing message it would be to enjoy the love letters when they are coming and in time to allow for the moments of death.